ID: 1129297620_1129297634

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1129297620 1129297634
Species Human (GRCh38) Human (GRCh38)
Location 15:74608618-74608640 15:74608652-74608674
Sequence CCTCCCACCTGCCCCTGGGCCAG TGGCCATATGTAGGCGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 106, 4: 839} {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!