ID: 1129313107_1129313112

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1129313107 1129313112
Species Human (GRCh38) Human (GRCh38)
Location 15:74725868-74725890 15:74725902-74725924
Sequence CCATCCTGGGGCGCGGGGACTCC TTTGCACCCACTGGAACGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!