ID: 1129319630_1129319636

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1129319630 1129319636
Species Human (GRCh38) Human (GRCh38)
Location 15:74767377-74767399 15:74767418-74767440
Sequence CCTCTTAGGAAAGGCATAGCCTC ATTTAGAGATGGAGAGACAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!