ID: 1129322376_1129322390

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1129322376 1129322390
Species Human (GRCh38) Human (GRCh38)
Location 15:74782312-74782334 15:74782356-74782378
Sequence CCTCTGGCCGCCGGAGCCCGCGG CGCGGCCCCGATCGAGCGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 224} {0: 1, 1: 0, 2: 0, 3: 2, 4: 26}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!