ID: 1129330695_1129330697

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1129330695 1129330697
Species Human (GRCh38) Human (GRCh38)
Location 15:74825818-74825840 15:74825833-74825855
Sequence CCTTCTGAGTACCTGGCTGGGAG GCTGGGAGTGCGCTCCAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 268} {0: 1, 1: 0, 2: 0, 3: 10, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!