ID: 1129336307_1129336323

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1129336307 1129336323
Species Human (GRCh38) Human (GRCh38)
Location 15:74854186-74854208 15:74854238-74854260
Sequence CCACAGCAGGATGAGTGATGTGC CTGCACTGGGCCTTCCCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 123} {0: 1, 1: 0, 2: 6, 3: 38, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!