ID: 1129336312_1129336328

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1129336312 1129336328
Species Human (GRCh38) Human (GRCh38)
Location 15:74854209-74854231 15:74854261-74854283
Sequence CCCTGCCTGTGAGGGGACTCCCT CTTCCCAGCCAACAAGCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 202} {0: 1, 1: 0, 2: 0, 3: 13, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!