ID: 1129348214_1129348225

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1129348214 1129348225
Species Human (GRCh38) Human (GRCh38)
Location 15:74937915-74937937 15:74937948-74937970
Sequence CCACGGCGGGGCCGGGGGTCCGG GGAGGCCTCGAGGGTCGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 382} {0: 1, 1: 1, 2: 1, 3: 14, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!