ID: 1129350780_1129350791

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1129350780 1129350791
Species Human (GRCh38) Human (GRCh38)
Location 15:74955023-74955045 15:74955061-74955083
Sequence CCTTTCCCTTAGTGGCGATGTAC CCCATTTGCAACAGCCTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49} {0: 1, 1: 0, 2: 0, 3: 15, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!