|
Left Crispr |
Right Crispr |
| Crispr ID |
1129367343 |
1129367353 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:75064471-75064493
|
15:75064513-75064535
|
| Sequence |
CCCAGATAGTCCTTTGGGGAGAA |
CAACCCTCGAACCAGGGACAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 7, 2: 14, 3: 24, 4: 120} |
{0: 3, 1: 10, 2: 6, 3: 15, 4: 103} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|