ID: 1129367347_1129367353

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1129367347 1129367353
Species Human (GRCh38) Human (GRCh38)
Location 15:75064481-75064503 15:75064513-75064535
Sequence CCTTTGGGGAGAATGTGGCAGGT CAACCCTCGAACCAGGGACAAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 8, 3: 35, 4: 408} {0: 3, 1: 10, 2: 6, 3: 15, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!