ID: 1129382055_1129382063

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1129382055 1129382063
Species Human (GRCh38) Human (GRCh38)
Location 15:75174258-75174280 15:75174285-75174307
Sequence CCCTTGTCACCCCTGCCCTGCAA GCCACCCTTTGCTCCCTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 325} {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!