ID: 1129387275_1129387283

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1129387275 1129387283
Species Human (GRCh38) Human (GRCh38)
Location 15:75202808-75202830 15:75202842-75202864
Sequence CCTGTGTGTCAGCCTGCTGGATG CGGCGCCGCCGGGAGGGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 170} {0: 1, 1: 0, 2: 1, 3: 36, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!