| 
        Left Crispr | 
        Right Crispr | 
      
    
    
      
        | Crispr ID | 
        1129387276 | 
        1129387281 | 
      
      
        | Species | 
        Human (GRCh38) | 
        Human (GRCh38) | 
      
      
        | Location | 
          
  
    
    
        
    
    15:75202820-75202842
   | 
          
  
    
    
        
    
    15:75202836-75202858
   | 
      
      
        | Sequence | 
        CCTGCTGGATGCACGTGCGTCTC | 
        GCGTCTCGGCGCCGCCGGGAGGG | 
      
      
        | Strand | 
        - | 
        + | 
      
      
        | Off-target summary | 
        {0: 1, 1: 0, 2: 0, 3: 5, 4: 101} | 
        {0: 1, 1: 0, 2: 0, 3: 2, 4: 74} | 
      
      
        | Status | 
                    Not started         | 
      
    
  
 
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
  
    | Spacer | 
    Left Crispr | 
    Right Crispr | 
  
  
     | 
    Location | 
    Sequence | 
    Mismatches | 
    Strand | 
    Location | 
    Sequence | 
    Mismatches | 
    Strand | 
  
  
  
    | 
      No off target data available for this pair!
      
      
      
     |