ID: 1129393798_1129393805

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1129393798 1129393805
Species Human (GRCh38) Human (GRCh38)
Location 15:75233659-75233681 15:75233681-75233703
Sequence CCAGGCCAGTGCTGATGGGGCTG GGTCCAGGTGGGGCCCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 338} {0: 1, 1: 0, 2: 4, 3: 54, 4: 399}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!