ID: 1129399094_1129399102

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1129399094 1129399102
Species Human (GRCh38) Human (GRCh38)
Location 15:75269434-75269456 15:75269468-75269490
Sequence CCCATTATTTTGGCTCCAGAGCA CTCCCGAAGGAGAAGGCGGACGG
Strand - +
Off-target summary {0: 5, 1: 12, 2: 10, 3: 14, 4: 172} {0: 4, 1: 1, 2: 1, 3: 6, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!