ID: 1129411297_1129411305

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1129411297 1129411305
Species Human (GRCh38) Human (GRCh38)
Location 15:75352007-75352029 15:75352045-75352067
Sequence CCAGTTTCCTTCCCCTTGCACCC GAGCCCCTCTCCCCATCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 467} {0: 1, 1: 0, 2: 7, 3: 246, 4: 3689}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!