ID: 1129411297_1129411309

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1129411297 1129411309
Species Human (GRCh38) Human (GRCh38)
Location 15:75352007-75352029 15:75352049-75352071
Sequence CCAGTTTCCTTCCCCTTGCACCC CCCTCTCCCCATCCCATGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 467} {0: 1, 1: 1, 2: 3, 3: 85, 4: 766}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!