ID: 1129433672_1129433676

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1129433672 1129433676
Species Human (GRCh38) Human (GRCh38)
Location 15:75520362-75520384 15:75520408-75520430
Sequence CCCAGATCAAAGTGCTCATCCTG CAGTAAGATTTTCACACTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 314} {0: 1, 1: 0, 2: 1, 3: 17, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!