ID: 1129449740_1129449743

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1129449740 1129449743
Species Human (GRCh38) Human (GRCh38)
Location 15:75644478-75644500 15:75644497-75644519
Sequence CCTGCAGGCTGCCACCAGCAGAG AGAGTCAGCCTGAAAACCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 302} {0: 1, 1: 0, 2: 2, 3: 20, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!