|
Left Crispr |
Right Crispr |
| Crispr ID |
1129449782 |
1129449791 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:75644728-75644750
|
15:75644775-75644797
|
| Sequence |
CCAGGAGTTTGAGATCAGCCTGG |
ACAAAAATACAAAAGTTGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1506, 1: 22882, 2: 43462, 3: 59071, 4: 50229} |
{0: 2, 1: 60, 2: 1971, 3: 16978, 4: 120628} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|