ID: 1129451166_1129451174

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1129451166 1129451174
Species Human (GRCh38) Human (GRCh38)
Location 15:75652126-75652148 15:75652153-75652175
Sequence CCTTTGCCCCTCTGGGCCTTAGT TGATCTGTAAAACAAGGGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 83, 4: 603} {0: 1, 1: 1, 2: 1, 3: 40, 4: 366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!