ID: 1129452103_1129452105

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1129452103 1129452105
Species Human (GRCh38) Human (GRCh38)
Location 15:75656927-75656949 15:75656940-75656962
Sequence CCCTCACACGCTGTCCTCTGCTC TCCTCTGCTCTGCCTATGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 315} {0: 1, 1: 0, 2: 3, 3: 34, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!