ID: 1129452106_1129452114

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1129452106 1129452114
Species Human (GRCh38) Human (GRCh38)
Location 15:75656941-75656963 15:75656985-75657007
Sequence CCTCTGCTCTGCCTATGCCAGGC AGCCAACGCATGAGTGACGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 295} {0: 1, 1: 0, 2: 0, 3: 6, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!