ID: 1129452111_1129452120

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1129452111 1129452120
Species Human (GRCh38) Human (GRCh38)
Location 15:75656965-75656987 15:75657012-75657034
Sequence CCTTCGCCAAGGTGAAGGAGAGC ATGGTGCAGGACGAGGCAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 95} {0: 1, 1: 0, 2: 0, 3: 25, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!