ID: 1129457795_1129457806

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1129457795 1129457806
Species Human (GRCh38) Human (GRCh38)
Location 15:75684945-75684967 15:75684980-75685002
Sequence CCAGCAGCACCCTTCATGCCCTG GGAGGAGACTGACTCTTTTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 335} {0: 2, 1: 0, 2: 6, 3: 15, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!