ID: 1129467703_1129467708

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1129467703 1129467708
Species Human (GRCh38) Human (GRCh38)
Location 15:75733129-75733151 15:75733143-75733165
Sequence CCTCCTCAGGTCATCCAGGGCAG CCAGGGCAGAAGCTTGGGCTAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 190} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!