ID: 1129470150_1129470152 |
View in Genome Browser |
Spacer: -7 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1129470150 | 1129470152 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 15:75749056-75749078 | 15:75749072-75749094 |
| Sequence | CCTGAAATAAATGAATAAAAGGA | AAAAGGAAACTTGTGGTTAGTGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 11, 3: 158, 4: 1150} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||