ID: 1129473658_1129473670

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1129473658 1129473670
Species Human (GRCh38) Human (GRCh38)
Location 15:75768770-75768792 15:75768800-75768822
Sequence CCTAGTGGCCCTGCCCAACCCAC AAGATGACTTCCTAGGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 334} {0: 1, 1: 0, 2: 0, 3: 13, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!