ID: 1129476314_1129476319

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1129476314 1129476319
Species Human (GRCh38) Human (GRCh38)
Location 15:75786518-75786540 15:75786534-75786556
Sequence CCTCCCTTCAGGTGAAGCTGCTG GCTGCTGGAGCTGCAGGAGCTGG
Strand - +
Off-target summary {0: 5, 1: 22, 2: 4, 3: 17, 4: 233} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!