ID: 1129504006_1129504021

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1129504006 1129504021
Species Human (GRCh38) Human (GRCh38)
Location 15:76065917-76065939 15:76065958-76065980
Sequence CCTATTCTGCCCCTCCTTCCCTG GCCGAGGGGTGCCCCTGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 82, 4: 735} {0: 1, 1: 0, 2: 1, 3: 25, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!