ID: 1129506048_1129506050

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1129506048 1129506050
Species Human (GRCh38) Human (GRCh38)
Location 15:76082422-76082444 15:76082474-76082496
Sequence CCAAGAGTTGGTCAGGAAGAGAG CAGAGTATTATGATGGAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 247} {0: 1, 1: 0, 2: 2, 3: 15, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!