ID: 1129512992_1129512998

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1129512992 1129512998
Species Human (GRCh38) Human (GRCh38)
Location 15:76138621-76138643 15:76138670-76138692
Sequence CCTACATGCAGGAACATGCTTAG CTAGGAGCTCTGCAGACATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 134} {0: 1, 1: 0, 2: 1, 3: 20, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!