ID: 1129517122_1129517131

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1129517122 1129517131
Species Human (GRCh38) Human (GRCh38)
Location 15:76163588-76163610 15:76163610-76163632
Sequence CCGCCCTTGGCTGAGGCCAGGCC CCAGCTGGCCACTTGGAACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 319} {0: 1, 1: 0, 2: 1, 3: 7, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!