ID: 1129517123_1129517131

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1129517123 1129517131
Species Human (GRCh38) Human (GRCh38)
Location 15:76163591-76163613 15:76163610-76163632
Sequence CCCTTGGCTGAGGCCAGGCCCAG CCAGCTGGCCACTTGGAACTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 43, 4: 400} {0: 1, 1: 0, 2: 1, 3: 7, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!