ID: 1129518330_1129518337

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1129518330 1129518337
Species Human (GRCh38) Human (GRCh38)
Location 15:76170540-76170562 15:76170576-76170598
Sequence CCTGCCCCGCTGGAGAGTTAGAG CACAGCTGAGATGCGGGTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 102} {0: 1, 1: 0, 2: 1, 3: 10, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!