ID: 1129530040_1129530047

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1129530040 1129530047
Species Human (GRCh38) Human (GRCh38)
Location 15:76258376-76258398 15:76258407-76258429
Sequence CCGGTCAGCTGCAGGGAAGCATC AACTTCTCCTGGCCTAGACAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 188} {0: 1, 1: 1, 2: 1, 3: 13, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!