|
Left Crispr |
Right Crispr |
| Crispr ID |
1129542085 |
1129542090 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:76358675-76358697
|
15:76358696-76358718
|
| Sequence |
CCTAAAAGCCCTGTCTCGAAATA |
TACAACTACATTGCAGGTTAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 7, 2: 76, 3: 240, 4: 720} |
{0: 1, 1: 0, 2: 3, 3: 29, 4: 259} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|