ID: 1129570775_1129570779

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1129570775 1129570779
Species Human (GRCh38) Human (GRCh38)
Location 15:76681892-76681914 15:76681922-76681944
Sequence CCATGCTCCTCTAGGAGATTTTA AGTGATTGTCAGACCTGGACAGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 31, 3: 39, 4: 211} {0: 1, 1: 0, 2: 1, 3: 11, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!