ID: 1129599275_1129599288

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1129599275 1129599288
Species Human (GRCh38) Human (GRCh38)
Location 15:76988828-76988850 15:76988868-76988890
Sequence CCTTCTTCCTCATCCTGTTTCTG TCACTGCCAGCCCCACACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 86, 4: 945} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!