ID: 1129621058_1129621060

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1129621058 1129621060
Species Human (GRCh38) Human (GRCh38)
Location 15:77146130-77146152 15:77146143-77146165
Sequence CCATCACTGTGCAGCAGCCTTGT GCAGCCTTGTCAAATGAATAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 481} {0: 1, 1: 0, 2: 1, 3: 18, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!