|
Left Crispr |
Right Crispr |
| Crispr ID |
1129632842 |
1129632844 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:77280152-77280174
|
15:77280178-77280200
|
| Sequence |
CCAACATGGTGAAATCTCAGTCT |
GTAAATACACAAAATTAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 7, 2: 162, 3: 1856, 4: 5825} |
{0: 1, 1: 25, 2: 1590, 3: 34610, 4: 99269} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|