ID: 1129644738_1129644751

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1129644738 1129644751
Species Human (GRCh38) Human (GRCh38)
Location 15:77419835-77419857 15:77419880-77419902
Sequence CCAGAGCCCCGGCGGCGGCGCCA AGAACCCGCGCCGCCCCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 292} {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!