ID: 1129644845_1129644858

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1129644845 1129644858
Species Human (GRCh38) Human (GRCh38)
Location 15:77420250-77420272 15:77420300-77420322
Sequence CCTGGAGCCGTGAGCACGCGCGC TCTCCCTCAGCCCCAGCGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 67} {0: 1, 1: 0, 2: 3, 3: 36, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!