ID: 1129677087_1129677093

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1129677087 1129677093
Species Human (GRCh38) Human (GRCh38)
Location 15:77637462-77637484 15:77637476-77637498
Sequence CCTCACCTTCCCCTCGGGCGGGG CGGGCGGGGCTGTATGTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 95, 4: 4844} {0: 1, 1: 0, 2: 0, 3: 10, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!