ID: 1129685890_1129685901

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1129685890 1129685901
Species Human (GRCh38) Human (GRCh38)
Location 15:77685977-77685999 15:77686026-77686048
Sequence CCCCAGGTGGGTGGTGGGCGGCT ATTTGGAAGCAGCTGGAGCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 25, 4: 187} {0: 1, 1: 0, 2: 2, 3: 19, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!