ID: 1129704853_1129704859

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1129704853 1129704859
Species Human (GRCh38) Human (GRCh38)
Location 15:77788257-77788279 15:77788270-77788292
Sequence CCCTCTGCGGCCCTCTATCATAC TCTATCATACTCCCCTGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 62} {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!