ID: 1129739878_1129739880

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1129739878 1129739880
Species Human (GRCh38) Human (GRCh38)
Location 15:77985060-77985082 15:77985080-77985102
Sequence CCGTCTGATGCCATGCTGATGCC GCCACCCATGTGCCCCCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 424} {0: 1, 1: 0, 2: 0, 3: 24, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!