ID: 1129741334_1129741342

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1129741334 1129741342
Species Human (GRCh38) Human (GRCh38)
Location 15:77991082-77991104 15:77991124-77991146
Sequence CCTAGAAAAGAGTCCTCAGCCAG GGGGCCTCCTGCGATCTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 14, 4: 254} {0: 1, 1: 0, 2: 0, 3: 10, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!