ID: 1129749569_1129749576

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1129749569 1129749576
Species Human (GRCh38) Human (GRCh38)
Location 15:78052021-78052043 15:78052069-78052091
Sequence CCACTGCTCTTAGGTTAAAGTCC CTCTCCCCCAGCTCTGGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 70, 4: 299} {0: 1, 1: 0, 2: 5, 3: 50, 4: 545}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!